You are 4700900 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
5C4J R, S, U1TRANSFERASE/DNA/RNAX-Ray Difraction42015-06-18


model 1
>strand_R
uCGAGAGGa
..(.(.(..
>strand_S
cgcuuguauauaaagaguccguggaagcucuccuagcagugcuuaucgguagg
---------........................(...--...)..........
>strand_U
ccuaccgauaagcagacgauccucucgaaccacggacucuuuauauacaagcg
...)))............---------..........................